Scientists discover a hidden and intentionally obvious message encoded in our DNA. What does it say and how does humanity react?
REKLAM
Cevaplar
""My name is God, and I do exist" Would have some interesting effects on the atheists. Not sure why it would be written in English though. Maybe the message is in a different language depending on what language the person - who's dna it is - speaks. "
REKLAM
""Help I'm trapped in a universe factory!" This mysterious author becomes the object of no less than 32 new religions. "
""dickbutt" Humanity is confused. "
Konami code.
""Eat your greens" Humanity- "F*** you DNA" or "well... ok." "
It says - clears throat - the secret is in the pudding. Humanity goes mad and all hell breaks loose. The final World War ensues.
""What do you get if you multiply six by nine?" Humanity finally understands the nature of the universe, and, discovering that something is fundamentally wrong with it, spirals into self-destruction. "
GGATCATAGCAGCTAGCGATAGC
(tm)
""Prisoner # " then humanity loses its mind over the fact that we are in fact living within some sort of prison. "
Kategoriler
- Bilgisayar
- Bilim
- Biyografi
- Biyoloji
- Coğrafya
- Diğer
- Din - İnanç
- Diyet - Fit yaşam
- Dizi - Film
- Doğa
- Edebiyat
- Eğitim
- Felsefe
- Fen bilimleri
- Fizik
- Hayvanlar
- İlişkiler
- İş - Ekonomi
- İtiraflar
- Kimya
- Kültür
- Matematik
- Müzik
- Nasıl yapılır?
- Oyunlar
- Psikoloji
- Sağlık
- Seyahat
- Siyaset
- Spor
- Stil - Moda
- Tarih
- Teknoloji
- Yabancı Dil
- Yazılım - Kodlama
- Yiyecek - İçecek
Susanne Keller adlı üyenin sorusuna 21 kişi cevap verdi.